• Thumbnail for T7 phage
    Bacteriophage T7 (or the T7 phage) is a bacteriophage, a virus that infects bacteria. It infects most strains of Escherichia coli and relies on these...
    17 KB (1,770 words) - 07:21, 27 August 2024
  • Thumbnail for T7 RNA polymerase
    initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7   TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA...
    9 KB (1,030 words) - 18:30, 12 June 2024
  • Thumbnail for Phage display
    bacteriophages used in phage display are M13 and fd filamentous phage, though T4, T7, and λ phage have also been used. Phage display was first described...
    38 KB (4,630 words) - 03:13, 22 June 2024
  • possesses a gene that is expressed to produce T7 RNA polymerase. (This polymerase originates from the T7 phage, a bacteriophage virus which infects E. coli...
    6 KB (798 words) - 17:50, 7 April 2024
  • Thumbnail for Bacteriophage
    Bacteriophage (redirect from Phage)
    186 phage λ phage Φ6 phage Φ29 phage ΦX174 Bacteriophage φCb5 G4 phage M13 phage MS2 phage (23–28 nm in size) N4 phage P1 phage P2 phage P4 phage R17...
    79 KB (8,393 words) - 00:30, 31 August 2024
  • T7 or T-7 may refer to: Thoracic vertebra 7 Thoracic spinal nerve 7 T7 phage, a virus used in the study of biological systems T7 DNA Helicase, a hexameric...
    1 KB (250 words) - 09:57, 3 May 2024
  • T7 DNA helicase (gp4) is a hexameric motor protein encoded by T7 phages that uses energy from dTTP hydrolysis to process unidirectionally along single...
    5 KB (538 words) - 17:10, 27 August 2024
  • Thumbnail for Teseptimavirus
    Teseptimavirus (synonyms T7 phage group, T7-like phages, T7-like viruses, T7likevirus) is a genus of viruses in the order Caudovirales, in the family Autographiviridae...
    5 KB (461 words) - 12:49, 30 January 2023
  • Thumbnail for T7 DNA polymerase
    Nucleotidyl transfer by DNA polymerase. T7 DNA polymerase catalyzes the phosphoryl transfer during DNA replication of the T7 phage. As shown in Figure 2, the 3’...
    22 KB (2,540 words) - 09:21, 17 June 2024
  • T7 phage in structure though the two viruses may differ in capsid maturation. FRASER, D; WILLIAMS, RC (Feb 1953). "Details of frozen-dried T3 and T7 bacteriophages...
    1 KB (143 words) - 18:29, 12 June 2024
  • infectious phage made. Proteases have been evolved to cut different peptides using PACE. In these systems, the desired protease cut site is used to link a T7 RNA...
    14 KB (1,432 words) - 00:00, 6 January 2024
  • bacteriophages. For example, T7 phages have two operons. The first operon codes for various products, including a special T7 RNA polymerase which can bind...
    21 KB (2,544 words) - 00:40, 27 April 2024
  • Filamentous phages retard bacterial growth but, contrasting with the lambda phage and the T7 phage, are not generally lytic. Helper phages are usually...
    5 KB (672 words) - 17:06, 26 August 2024
  • The T7 Holin family (TC# 1.E.6) is a member of the Holin Superfamily II. Members of this family are predominantly found in Caudovirales and Pseudomonadota...
    5 KB (401 words) - 19:27, 2 May 2022
  • GP5 could refer to several things: GP5 (gene) T7 phage, or Gp5 GP5 chip, computer chip GP-5 gas mask, Soviet civilian gas mask This disambiguation page...
    189 bytes (61 words) - 01:20, 25 January 2020
  • DnaG primases can have extra functions, if given the right domains. The T7 phage gp4 is a DnaG primase-helicase fusion, and performs both functions in replication...
    20 KB (2,371 words) - 16:05, 10 July 2024
  • Thumbnail for MRNA vaccine
    promoter and sequence which corresponds to the mRNA construct. By combining T7 phage RNA polymerase and the plasmid DNA, the mRNA can be transcribed in the...
    77 KB (7,879 words) - 16:49, 14 July 2024
  • Thumbnail for Twinkle (protein)
    Twinkle is a mitochondrial protein with structural similarity to the phage T7 primase/helicase (GP4) and other hexameric ring helicases. The twinkle...
    15 KB (1,860 words) - 21:54, 1 February 2024
  • Bacteriophages (phages), potentially the most numerous "organisms" on Earth, are the viruses of bacteria (more generally, of prokaryotes). Phage ecology is...
    22 KB (2,634 words) - 00:31, 14 June 2024
  • event and planetary ejection Atmospheric reentry Simulated conditions T7 phage Canine hepatitis Influenza PR8 Tobacco mosaic virus Vaccinia virus Yeast...
    47 KB (3,687 words) - 07:32, 2 July 2024
  • Thumbnail for Salmonella virus P22
    virion include bacteriophages λ and Ε34. Many Podoviridae, for example phages T7 and Φ29, share few DNA similarities with P22, even though their virion...
    11 KB (1,286 words) - 18:26, 15 April 2024
  • Thumbnail for Lysin
    Lysin (redirect from Phage lysin)
    when resistance is forced by mutagenesis experiments. Double-stranded DNA phage lysins tend to lie within the 25 to 40 kDa range in terms of size. A notable...
    16 KB (1,989 words) - 07:05, 27 July 2024
  • Thumbnail for Autographiviridae
    Enterobacteriaceae phages SP6 and K1-5 were the first to be considered as an estranged subgroup of the "T7 supergroup". Pseudomonas phage phiKMV also shared...
    16 KB (1,625 words) - 22:30, 27 July 2024
  • Thumbnail for Drew Endy
    from Dartmouth College in 1997 for his work on genetic engineering using T7 phage. Endy was a junior fellow for three years and later an Assistant Professor...
    10 KB (763 words) - 04:01, 12 August 2024
  • environment and mutation severity as revealed by in silico mutagenesis of phage T7. Genetics. 160:1273-1281. Schuppli, D., J. Georgijevic, and H. Weber. 2000...
    18 KB (2,791 words) - 08:56, 5 December 2019
  • Although phiKMV phage resembles the well-studied podovirus T7 in overall genome architecture, it was the first known T7-like phage which encoded a single-subunit...
    5 KB (505 words) - 06:47, 5 January 2024
  • Thumbnail for EXPOSE
    (Bacillus subtilis). PUR (ROSE-8), study of space environment effect on T7 phage, its DNA and of polycristalline uracil. IMBP (Institute of Biomedical Problems)...
    63 KB (7,283 words) - 23:03, 30 November 2023
  • small family that includes members derived from a number of Burkholderia phage as well as a Poloromonas species. As of April 3, 2016, this family belongs...
    4 KB (438 words) - 07:06, 16 April 2022
  • Thumbnail for Pseudomonas
    "Genomic Analysis of Pseudomonas aeruginosa Phages LKD16 and LKA1: Establishment of the φKMV Subgroup within the T7 Supergroup". Journal of Bacteriology. 188...
    95 KB (8,005 words) - 21:11, 3 July 2024
  • effect of differential methylation by Escherichia coli of plasmid DNA and phage T7 and λ DNA on the cleavage by restriction endonuclease MboI from Moraxella...
    3 KB (199 words) - 00:24, 6 August 2022