• 1995 Kuratong Baleleng killings (category Presidency of Fidel V. Ramos)
    3 days, Cascalang send requests to Roco, and to CHR chairman for the documents related, and the CHR formalized the document the next day. The same day...
    16 KB (1,725 words) - 10:11, 10 October 2024
  • Thumbnail for WWKZ
    the FCC Licensing and Management System WWKZ in Nielsen Audio's FM station database 34°12′18″N 88°41′49″W / 34.205°N 88.697°W / 34.205; -88.697 v t e...
    2 KB (194 words) - 19:48, 11 August 2024
  • Thumbnail for List of compositions by Johann Sebastian Bach
    "Angeblich von J. S. Bach komponierte Oden von Chr. H. von Hoffmannswaldau" [Likely by J. S. Bach composed odes of Chr. H. von Hoffmannswaldau]. In Schering,...
    61 KB (9,887 words) - 06:31, 7 August 2024
  • Thumbnail for Integrin alpha V
    proliferation and vascularisation". Endocrine-Related Cancer. 27 (12): 685–697. doi:10.1530/ERC-20-0353. PMID 33112795. Waisberg J, De Souza Viana L, Affonso...
    8 KB (767 words) - 09:34, 21 September 2024
  • Thumbnail for Epidermal growth factor receptor
    for trafficking and signaling". BioEssays. 22 (8): 697–707. doi:10.1002/1521-1878(200008)22:8<697::AID-BIES3>3.0.CO;2-1. PMID 10918300. S2CID 767308....
    60 KB (6,879 words) - 14:26, 16 July 2024
  • Thumbnail for Ptolemy XII Auletes
    ISBN 0415201454. Huß, Werner (2001). "Ägypten in hellenistischer Zeit 332–30 v. Chr. (Egypt in Hellenistic times 332–30 BC)". The Journal of Egyptian Archaeology...
    44 KB (4,626 words) - 16:19, 26 August 2024
  • Thumbnail for Sandvik
    v t e OMX Nordic 40 companies Denmark Ambu Carlsberg Chr. Hansen Coloplast Danske Bank DSV Genmab GN Store Nord Novo Nordisk Ørsted Vestas Wind Systems...
    20 KB (1,859 words) - 17:14, 17 September 2024
  • Altbabylonische Zeichenliste der sumerisch-literarischen Texte, Fribourg (2006). Chr. Rüster, E. Neu, Hethitisches Zeichenlexikon, Wiesbaden (1989). sign list...
    146 KB (534 words) - 15:10, 25 April 2024
  • Thumbnail for List of monarchs of Persia
    Dandamaev, Muhammad A., "Persien unter den ersten Achämeniden (6. Jahrhundert v. Chr.)", tr. Heinz-Dieter Pohl, Wiesbaden, 1976. Qashqai, H., "The successors...
    119 KB (1,724 words) - 17:05, 1 October 2024
  • Thumbnail for Polycystic kidney disease
    cM of chromosome 1". Journal of Medical Genetics. 27 (11): 697–700. doi:10.1136/jmg.27.11.697. PMC 1017261. PMID 1980516. Kimberling WJ, Kumar S, Gabow...
    27 KB (2,796 words) - 22:39, 25 September 2024
  • also used in Metro Manila. E.g.: NFD-838, PAX-329, PGU-909, TAX-798, TFN-697, TSB-466, UGE-522, UTH-468, WBU-389, WSD-220, XAF-789, XDG-289, XHK-537,...
    106 KB (3,700 words) - 17:50, 9 October 2024
  • GAATTCTGTGGGTGACTTTGTG Reverse 5′→ 3′: GCACAGTGAAGAATGTGGGAC Position: [1] chrY:11,907,522 dbSNP151: rs765685783 Q-L804 is defined by the SNPs L804 and...
    9 KB (1,043 words) - 07:03, 8 October 2024
  • Thumbnail for Last Supper
    ISBN 978-90-04-16963-0. Retrieved 1 August 2022. Luke 22:19b–20 Marshall et al. 1996, p. 697. Blomberg 2009, p. 333. Mark 14:22–24 Matthew 26:26–28 1 Corinthians 11:23–25...
    53 KB (5,792 words) - 17:04, 21 September 2024
  • Thumbnail for Mycenaean Greece
    Welt und Troja". In Hänsel, B. (ed.). Südosteuropa zwischen 1600 und 1000 V. Chr (in German). Berlin: Moreland Editions. pp. 65–88. Higgins, Reynold Alleyne...
    155 KB (17,601 words) - 02:43, 30 August 2024
  • Thumbnail for Alpha-fetoprotein
    V, Kumari K, Dixit A, Sahib MK (1991). "Interaction of human alpha fetoprotein with bilirubin". Indian Journal of Experimental Biology. 28 (7): 697–8...
    22 KB (2,652 words) - 07:15, 5 June 2024
  • Thumbnail for Cyclooxygenase
    the enzyme (which Ile523 sterically hinders). Drug molecules, such as DuP-697 and the coxibs derived from it, bind to this alternative site and are considered...
    16 KB (1,779 words) - 11:08, 3 July 2024
  • media notes}}: CS1 maint: others in cite AV media (notes) (link) "Issue 697" ARIA Top 40 Urban Singles. National Library of Australia. Retrieved February...
    101 KB (8,726 words) - 02:44, 7 October 2024
  • Thumbnail for Septuagint manuscripts
    antiquity small fragments of the Greek Old Testament without the Psalms) Part V: 1001–1400 (psalms from the twelfth century) Part VI: 1401–2000 (medieval...
    262 KB (816 words) - 06:42, 9 August 2024
  • Thumbnail for Acetylcholinesterase
    Neuroscience (2nd ed.). Sunderland (MA): Sinauer Associates. ISBN 978-0-87893-697-7. Quinn DM (1987). "Acetylcholinesterase: enzyme structure, reaction dynamics...
    35 KB (3,880 words) - 16:55, 22 July 2024
  • Thumbnail for Granulocyte-macrophage colony-stimulating factor
    superoxide and limits intracellular pathogen survival". Immunity. 39 (4): 697–710. doi:10.1016/j.immuni.2013.09.006. PMC 3841917. PMID 24138881. Hansen...
    17 KB (1,672 words) - 11:59, 30 August 2023
  • the male settlers of Iceland". American Journal of Human Genetics. 67 (3): 697–717. doi:10.1086/303046. PMC 1287529. PMID 10931763. "The Greater Nordic...
    67 KB (5,676 words) - 07:35, 8 October 2024
  • Thumbnail for Keratin 1
    carboxyl-terminal V2 subdomain". The Journal of Investigative Dermatology. 99 (6): 697–702. doi:10.1111/1523-1747.ep12614149. PMID 1281859. Compton JG, DiGiovanna...
    11 KB (1,260 words) - 19:29, 2 December 2023
  • Thumbnail for Bergen
    stable at around 2% in the period. The number of Poles in Bergen rose from 697 in 2006 to 3,128 in 2010. As of 2022, immigrants of non-Western origin and...
    124 KB (9,337 words) - 00:42, 25 September 2024
  • Thumbnail for Neuropeptide Y
    Aliases NPY, PYY4, Neuropeptid Y gene, neuropeptide Y External IDs OMIM: 162640; MGI: 97374; HomoloGene: 697; GeneCards: NPY; OMA:NPY - orthologs Wikidata...
    32 KB (3,679 words) - 18:58, 13 March 2024
  • Thumbnail for Natriuretic peptide precursor C
    line, THP-1". Biochemical and Biophysical Research Communications. 189 (2): 697–704. doi:10.1016/0006-291X(92)92257-X. PMID 1472040. Komatsu Y, Nakao K,...
    10 KB (1,271 words) - 04:55, 23 December 2023
  • Thumbnail for ERAP2
    aminopeptidase complexes in the endoplasmic reticulum". Nature Immunology. 6 (7): 689–697. doi:10.1038/ni1208. PMID 15908954. Evnouchidou I, Weimershaus M, Saveanu...
    25 KB (2,626 words) - 03:44, 28 August 2024
  • Thumbnail for Nephrin
    Kidney Dis. 40 (4): 697–703. doi:10.1053/ajkd.2002.35676. PMID 12324903. Saleem MA, Ni L, Witherden I, Tryggvason K, Ruotsalainen V, Mundel P, Mathieson...
    13 KB (1,560 words) - 13:04, 22 September 2024
  • sleeve). t.A.T.u. Interscope Records, Universal Music Russia. 2003. 019 697-4.{{cite AV media notes}}: CS1 maint: others in cite AV media (notes) (link)...
    82 KB (8,366 words) - 12:18, 4 October 2024
  • Thumbnail for Nubia
    Pennsylvania. Raue, Dietrich (2019). Elephantine und Nubien vom 4.-2. Jahrtausend v. Chr. Berlin/Boston: Walter de Gruyter. ISBN 9783110501056. Thelwall, Robin (1982)...
    113 KB (12,997 words) - 03:30, 5 October 2024
  • 2008: proceedings. Lecture Notes in Computer Science. Vol. 5366. pp. 693–697. doi:10.1007/978-3-540-89982-2_59. ISBN 978-3-540-89982-2. Apt, K. R.; Marchiori...
    69 KB (7,938 words) - 23:50, 17 September 2024