1995 Kuratong Baleleng killings (category Presidency of Fidel V. Ramos)
3 days, Cascalang send requests to Roco, and to CHR chairman for the documents related, and the CHR formalized the document the next day. The same day...
16 KB (1,725 words) - 10:11, 10 October 2024
the FCC Licensing and Management System WWKZ in Nielsen Audio's FM station database 34°12′18″N 88°41′49″W / 34.205°N 88.697°W / 34.205; -88.697 v t e...
2 KB (194 words) - 19:48, 11 August 2024
"Angeblich von J. S. Bach komponierte Oden von Chr. H. von Hoffmannswaldau" [Likely by J. S. Bach composed odes of Chr. H. von Hoffmannswaldau]. In Schering,...
61 KB (9,887 words) - 06:31, 7 August 2024
proliferation and vascularisation". Endocrine-Related Cancer. 27 (12): 685–697. doi:10.1530/ERC-20-0353. PMID 33112795. Waisberg J, De Souza Viana L, Affonso...
8 KB (767 words) - 09:34, 21 September 2024
Epidermal growth factor receptor (redirect from Oncogene proteins v-erbb)
for trafficking and signaling". BioEssays. 22 (8): 697–707. doi:10.1002/1521-1878(200008)22:8<697::AID-BIES3>3.0.CO;2-1. PMID 10918300. S2CID 767308....
60 KB (6,879 words) - 14:26, 16 July 2024
ISBN 0415201454. Huß, Werner (2001). "Ägypten in hellenistischer Zeit 332–30 v. Chr. (Egypt in Hellenistic times 332–30 BC)". The Journal of Egyptian Archaeology...
44 KB (4,626 words) - 16:19, 26 August 2024
v t e OMX Nordic 40 companies Denmark Ambu Carlsberg Chr. Hansen Coloplast Danske Bank DSV Genmab GN Store Nord Novo Nordisk Ørsted Vestas Wind Systems...
20 KB (1,859 words) - 17:14, 17 September 2024
Altbabylonische Zeichenliste der sumerisch-literarischen Texte, Fribourg (2006). Chr. Rüster, E. Neu, Hethitisches Zeichenlexikon, Wiesbaden (1989). sign list...
146 KB (534 words) - 15:10, 25 April 2024
Dandamaev, Muhammad A., "Persien unter den ersten Achämeniden (6. Jahrhundert v. Chr.)", tr. Heinz-Dieter Pohl, Wiesbaden, 1976. Qashqai, H., "The successors...
119 KB (1,724 words) - 17:05, 1 October 2024
cM of chromosome 1". Journal of Medical Genetics. 27 (11): 697–700. doi:10.1136/jmg.27.11.697. PMC 1017261. PMID 1980516. Kimberling WJ, Kumar S, Gabow...
27 KB (2,796 words) - 22:39, 25 September 2024
also used in Metro Manila. E.g.: NFD-838, PAX-329, PGU-909, TAX-798, TFN-697, TSB-466, UGE-522, UTH-468, WBU-389, WSD-220, XAF-789, XDG-289, XHK-537,...
106 KB (3,700 words) - 17:50, 9 October 2024
GAATTCTGTGGGTGACTTTGTG Reverse 5′→ 3′: GCACAGTGAAGAATGTGGGAC Position: [1] chrY:11,907,522 dbSNP151: rs765685783 Q-L804 is defined by the SNPs L804 and...
9 KB (1,043 words) - 07:03, 8 October 2024
ISBN 978-90-04-16963-0. Retrieved 1 August 2022. Luke 22:19b–20 Marshall et al. 1996, p. 697. Blomberg 2009, p. 333. Mark 14:22–24 Matthew 26:26–28 1 Corinthians 11:23–25...
53 KB (5,792 words) - 17:04, 21 September 2024
Welt und Troja". In Hänsel, B. (ed.). Südosteuropa zwischen 1600 und 1000 V. Chr (in German). Berlin: Moreland Editions. pp. 65–88. Higgins, Reynold Alleyne...
155 KB (17,601 words) - 02:43, 30 August 2024
V, Kumari K, Dixit A, Sahib MK (1991). "Interaction of human alpha fetoprotein with bilirubin". Indian Journal of Experimental Biology. 28 (7): 697–8...
22 KB (2,652 words) - 07:15, 5 June 2024
the enzyme (which Ile523 sterically hinders). Drug molecules, such as DuP-697 and the coxibs derived from it, bind to this alternative site and are considered...
16 KB (1,779 words) - 11:08, 3 July 2024
media notes}}: CS1 maint: others in cite AV media (notes) (link) "Issue 697" ARIA Top 40 Urban Singles. National Library of Australia. Retrieved February...
101 KB (8,726 words) - 02:44, 7 October 2024
Septuagint manuscripts (section Part V: 1001–1400)
antiquity small fragments of the Greek Old Testament without the Psalms) Part V: 1001–1400 (psalms from the twelfth century) Part VI: 1401–2000 (medieval...
262 KB (816 words) - 06:42, 9 August 2024
Neuroscience (2nd ed.). Sunderland (MA): Sinauer Associates. ISBN 978-0-87893-697-7. Quinn DM (1987). "Acetylcholinesterase: enzyme structure, reaction dynamics...
35 KB (3,880 words) - 16:55, 22 July 2024
superoxide and limits intracellular pathogen survival". Immunity. 39 (4): 697–710. doi:10.1016/j.immuni.2013.09.006. PMC 3841917. PMID 24138881. Hansen...
17 KB (1,672 words) - 11:59, 30 August 2023
carboxyl-terminal V2 subdomain". The Journal of Investigative Dermatology. 99 (6): 697–702. doi:10.1111/1523-1747.ep12614149. PMID 1281859. Compton JG, DiGiovanna...
11 KB (1,260 words) - 19:29, 2 December 2023
stable at around 2% in the period. The number of Poles in Bergen rose from 697 in 2006 to 3,128 in 2010. As of 2022, immigrants of non-Western origin and...
124 KB (9,337 words) - 00:42, 25 September 2024
Aliases NPY, PYY4, Neuropeptid Y gene, neuropeptide Y External IDs OMIM: 162640; MGI: 97374; HomoloGene: 697; GeneCards: NPY; OMA:NPY - orthologs Wikidata...
32 KB (3,679 words) - 18:58, 13 March 2024
the male settlers of Iceland". American Journal of Human Genetics. 67 (3): 697–717. doi:10.1086/303046. PMC 1287529. PMID 10931763. "The Greater Nordic...
67 KB (5,676 words) - 07:35, 8 October 2024
Ägypten : die Zeitbestimmung der ägyptischen Geschichte von der Vorzeit bis 332 v. Chr. Mainz am Rhein. p. 190. ISBN 3805323107. OCLC 932193922. Lipschits, Oled...
137 KB (1,336 words) - 13:00, 26 August 2024
line, THP-1". Biochemical and Biophysical Research Communications. 189 (2): 697–704. doi:10.1016/0006-291X(92)92257-X. PMID 1472040. Komatsu Y, Nakao K,...
10 KB (1,271 words) - 04:55, 23 December 2023
aminopeptidase complexes in the endoplasmic reticulum". Nature Immunology. 6 (7): 689–697. doi:10.1038/ni1208. PMID 15908954. Evnouchidou I, Weimershaus M, Saveanu...
25 KB (2,626 words) - 03:44, 28 August 2024
Kidney Dis. 40 (4): 697–703. doi:10.1053/ajkd.2002.35676. PMID 12324903. Saleem MA, Ni L, Witherden I, Tryggvason K, Ruotsalainen V, Mundel P, Mathieson...
13 KB (1,560 words) - 13:04, 22 September 2024
Injunktiv und zum Drei-Genus-System im Ur-Indogermanischen (Ca. 3000-2500 v. CHR.)". Studia Linguistica. Diachronica et Synchronica. pp. 435–466. doi:10...
341 KB (8,992 words) - 06:24, 9 October 2024
sleeve). t.A.T.u. Interscope Records, Universal Music Russia. 2003. 019 697-4.{{cite AV media notes}}: CS1 maint: others in cite AV media (notes) (link)...
82 KB (8,366 words) - 12:18, 4 October 2024